BStools

W.A.F.U. ultravioleta 🍉

@vinylcookies.bsky.social

334 followers, 430 follows, 5,096 posts

Registered:18 Oct 2023 20:00

Follow date:5 Mar 2026 16:11

Last post:12 hours ago

Last like given:11 hours ago

Last like received:12 hours ago

Musicófaga, algo technócrata, y tripolar. Graphic Designer 24/7 & Senior Candy Raver a tiempo parcial. Muy micronista ocasional. Lo del S.XXI lo llevo regular.

btpai

@btpai.bsky.social

19 followers, 58 follows, 215 posts

Registered:24 Oct 2024 17:45

Follow date:25 Feb 2026 11:04

Last post:43 minutes ago

Last like given:13 hours ago

Last like received:38 minutes ago

Madia Leva

@madialeva.bsky.social

128 followers, 99 follows, 632 posts

Registered:20 Oct 2023 21:48

Follow date:24 Feb 2026 15:14

Last post:3 hours ago

Last like given:2 hours ago

Last like received:1 hour ago

Señora mayor de vuelta al mundo laboral 😸

Tamara Hernández-Verdeja

@tamara-hverdeja.bsky.social

348 followers, 611 follows, 155 posts

Registered:3 Mar 2025 13:51

Follow date:17 Feb 2026 16:44

Last post:15 hours ago

Last like given:3 hours ago

Last like received:4 hours ago

Plant scientist 🌱 Ramon y Cajal researcher at CBGP. Interested in how plants develop and adapt to environmental changes, and chloroplasts. Opinions are my own. She/Her.🖖

Carlos

@plasmidobinario.satan.social

739 followers, 485 follows, 12,027 posts

Registered:28 Nov 2023 08:36

Follow date:14 Feb 2026 12:27

Last post:7 minutes ago

Last like given:9 minutes ago

Last like received:50 minutes ago

Biólogo de plantitas. Rojo de mierda. Explorando electrónica/impresión 3D. Intento formar arbolitos como bonsáis. También toco la guitarra. No esperes cosas demasiado serias de este perfil. Soy un personaje 😂🤘🏻 Blog: https://plasmidobinario.wordpr...

Ysa Rainfox. Brujita sureña🪶 🐕🐢🏳️‍🌈🇵🇸

@ladymusarana.bsky.social

182 followers, 520 follows, 1,046 posts

Registered:12 Nov 2024 14:50

Follow date:14 Feb 2026 07:29

Last post:1 day ago

Last like given:3 hours ago

Last like received:1 day ago

Ella/Elle She/They Bichóloga, desgracia con patas, destructora de estirpes, caótica torcida. Aprendiendo a ser profe. Vivo en tierra imaginaria. LGT(B)I+ 🏳️‍🌈 Demigirl, Poliamor #Artesaniaspajariles #reseñascaoticas #Emplumación2025

🍃Ceramikratom🌿

@ceramikratomuwu.bsky.social

61 followers, 77 follows, 468 posts

Registered:21 Jan 2026 13:16

Follow date:13 Feb 2026 12:03

Last post:16 hours ago

Last like given:30 minutes ago

Last like received:17 hours ago

🇵🇸 Me gusta la cerámica, la droga, los tattoos, la musika, el anime, pokemon y la wwe ah y soy vegano. Odio a todos los políticos, a los rikos a los jueces a los polis y las fronteras Padre de dos michis y un perrete vejete 🐶🐱🐱 A y me quieren preso UwU

Clau D. ✨VGen available ✨

@clauwagart.bsky.social

433 followers, 767 follows, 978 posts

Registered:17 Oct 2024 07:37

Follow date:10 Feb 2026 21:24

Last post:3 days ago

Last like received:12 hours ago

Illustration, Character Designer & Comic Artist | 🇪🇸🇬🇧 | 2X | IG: instagram.com/clauwagart Porfolio: artstation.com/clauwaga Comms: vgen.co/clauwagart Shop: https://acggoods.com/store/cla... Links: linktr.ee/clauwaga ✉️clauwaga@gmail.com #VGen #yume #oc

manukord

@manukord.bsky.social

532 followers, 987 follows, 1,448 posts

Registered:20 Sep 2023 15:55

Follow date:8 Feb 2026 11:23

Last post:5 days ago

Last like received:4 hours ago

- Looks pure 🌸, is horny 🔞 - History, animation and bird lover - 31 añitos - TEA - Bastante gamer - Le hago rt a dibujos NSFW aviso - Free Palestine 🇵🇸

Alver Vonleska

@alverspin.bsky.social

163 followers, 990 follows, 1,088 posts

Registered:19 Oct 2023 09:39

Follow date:7 Feb 2026 20:33

Last post:18 hours ago

Last like given:18 hours ago

1984. La vida se me hace bola Tuve una tienda de videojuegos (Pixeles Sevilla). A veces soy gamedev y he escrito cosas sobre videojuegos. Hago arte. TDAH También cine, música, arte, política, un poco de mí y lo que se me ocurra

LaLali

@lalali.bsky.social

1,577 followers, 822 follows, 20,547 posts

Registered:28 Sep 2023 15:08

Follow date:7 Feb 2026 09:55

Last post:3 hours ago

Last like given:3 hours ago

Last like received:3 seconds ago

Señora distinguida y punki de arrabal. Título oficial de DiviFF❤️ (DiviFemmeFatale/DiviFastForward, dependiendo del día) cortesía de @esnupyna.aldea.social Conovia II. Normal. Ella/she/her

Un Lápiz HB ✏️

@lapizhb.bsky.social

211 followers, 401 follows, 1,364 posts

Registered:18 Oct 2024 16:55

Follow date:4 Feb 2026 21:40

Last post:14 hours ago

Last like given:30 minutes ago

Last like received:11 hours ago

Nvl 20. Jugador competitivo de Animal Crossing 🦝, rolero 🐉 y artista cuando la universidad lo permite. Me gustan las urracas. Subo fotos de pájaros y dibujitos. he/him/illo ESP/EN

meri

@minimeri.eurosky.social

336 followers, 342 follows, 2,606 posts

Registered:31 Jul 2023 11:29

Follow date:3 Feb 2026 10:34

Last post:1 hour ago

Last like given:5 hours ago

Last like received:53 minutes ago

• A warm heart with a free soul • •Woman in Tech · GIF Sensei · Design · Neuroscience · Horses · Cats • • Nolite Te Bastardes Carborundorum • GCAAGGACATATGGGCGAAGGAGA 🏳️‍🌈 ❤️💜💙

C Cano

@consocano.bsky.social

842 followers, 853 follows, 1,486 posts

Registered:11 Oct 2023 18:57

Follow date:3 Feb 2026 10:34

Last post:11 hours ago

Last like given:22 minutes ago

Last like received:31 minutes ago

Aquí, de rebote.

★ Blanca ★

@blancatt.bsky.social

447 followers, 329 follows, 4,465 posts

Registered:22 Dec 2023 13:36

Follow date:3 Feb 2026 10:34

Last post:3 hours ago

Last like given:27 minutes ago

Last like received:3 hours ago

Arte, videojuegos y educación 🎨🎮👩🏽‍🏫 Me gusta interactuar con la gente ^^ https://ngl.link/blancatt

gloria_jb

@gloriajb.bsky.social

183 followers, 257 follows, 1,218 posts

Registered:15 Nov 2023 12:10

Follow date:1 Feb 2026 10:59

Last post:2 days ago

Last like given:7 hours ago

29🌻 Soy maja, a veces. Me gusta el café, el otoño y ✨derrocar el capitalismo✨.

Zelorio

@zelorio.bsky.social

480 followers, 156 follows, 8,506 posts

Registered:23 Oct 2023 14:26

Follow date:31 Jan 2026 23:37

Last post:2 hours ago

Last like given:28 minutes ago

Last like received:1 hour ago

🏳️‍🌈Fan de Tina Turner, de levantarme tarde, friki y adorador de Cthulhu.🏳️‍🌈🎬🎧🎮🎲

moon 🦈

@9yue.bsky.social

85 followers, 163 follows, 607 posts

Registered:1 Jul 2023 18:33

Follow date:30 Jan 2026 14:59

Last post:10 hours ago

Last like given:16 hours ago

Last like received:3 hours ago

30 ⋆ them ⋆ multifandom ⋆ sevilla, my beloved (つ✧ω✧)つ #matchablossom #dango3 #oc #itafushikugi #shimeji #knitting #crochet #embroidery #journaling #crossstitch

░▒▓█ounɹɹǝdƃnq█▓▒░

@bugperruno.bsky.social

605 followers, 385 follows, 845 posts

Registered:20 Sep 2023 17:52

Follow date:27 Jan 2026 15:26

Last post:12 hours ago

Last like given:2 hours ago

Last like received:51 minutes ago

🙋♀️I'm Bug or Ar 🌿Friki Artist ☠️Lvl 37 🎨Ilustration | Pixel Art | Watercolor 💬Spanish and english ✨Commission open Twitter/Twitch/Tumblr: Bugperruno Cuenta multifandom Digimon, Pokemon, .Hack//, larp ,FinalFantasy KingdomHearts, Perc'ahlia

Clouds ☁

@mariaenlasnubes.bsky.social

99 followers, 96 follows, 1,721 posts

Registered:2 Jan 2026 21:59

Follow date:26 Jan 2026 21:31

Last post:14 seconds ago

Last like given:26 seconds ago

Last like received:54 seconds ago

♎♈♏ P.A.S. 🍃 Autumn girl 🍂 Overthinker 🧠 I don't trust it but i want to✨ Blooming 🌼 Piso 30 de la dungeon ⚔️ ⟭⟬⁷

Eternia (...y pollo 🐔)

@eterniatattoo.bsky.social

113 followers, 82 follows, 1,642 posts

Registered:3 Nov 2023 12:27

Follow date:24 Jan 2026 10:40

Last post:2 hours ago

Last like given:2 hours ago

Last like received:1 hour ago

Tatuador en Eternia tattoo, amante del cine de terror y slasher. De los cómics ,de la buena música y de los buenos ratos con amigues. Para les que les interese, mi IG: @eterniatattoo

🌙 🍉 Anushka 🏳️‍🌈 ✨

@anushkabenari.eurosky.social

2,019 followers, 1,900 follows, 10,419 posts

Registered:19 Aug 2023 11:21

Follow date:23 Jan 2026 08:12

Last post:44 minutes ago

Last like given:40 minutes ago

Last like received:2 seconds ago

«La belleza perece en la vida pero es inmortal en el arte» | Oficinista de día, lectora de noche | She/Her | #caffeinaholic #kunst #archaeology #musik | Ἀθηνᾶ Πρόμαχος

|[Kyo ]| Kyute Art 🍓 VGen

@kyuteartist.bsky.social

1,276 followers, 443 follows, 4,091 posts

Registered:17 Oct 2023 20:27

Follow date:22 Jan 2026 22:32

Last post:2 hours ago

Last like given:2 hours ago

Last like received:13 hours ago

• ENG/ESP • 🍓 Drawing cute & pretty girls 🍓 Commissions: vgen.co/KyuteArt/ 🍓 Links: kyuteart.carrd.co/ Tags >> #art #kyuteart AIGen = Block 🚫 🇵🇸 FREE PALESTINE

🍉Hannya García ☕❤️📕

@hannyagarcia.bsky.social

15 followers, 45 follows, 27 posts

Registered:26 Dec 2023 09:51

Follow date:12 Jan 2026 16:37

Last post:7 days ago

Last like given:20 hours ago

14.3 billion years 🌌🏳‍🌈 Illustration//ESP-EN//🚫IA/AI

Anya Zeppeli 🧵ENCARGOS ABIERTOS🧵

@anyazep.bsky.social

91 followers, 89 follows, 474 posts

Registered:20 Sep 2023 20:00

Follow date:2 Jan 2026 13:24

Last post:3 days ago

Last like given:17 hours ago

🧵Artesana de Peluches Fieltro🧵 🎨Dibujos a Tradicional🎨 💮Encargos Abiertos💮 ✨Crazy Cat Lady✨🐈 🍀NoFollowBack🍀 Banner @FukurouComics Avatar @Shinkoart

Mandonguilla D'Abaetxo 🍉 🏳️‍🌈🏳️‍⚧️🇺🇦🇪🇺🇪🇦

@mandonguillad.aldea.social

869 followers, 846 follows, 9,391 posts

Registered:14 Oct 2023 06:38

Follow date:30 Dec 2025 17:39

Last post:37 minutes ago

Last like given:38 minutes ago

Last like received:1 minute ago

Les millors mandonguilles les de ma uela 😋

Formato Erróneo

@formatoerroneo.bsky.social

454 followers, 574 follows, 7,233 posts

Registered:13 Oct 2023 20:08

Follow date:20 Dec 2025 13:49

Last post:5 hours ago

Last like given:41 minutes ago

Last like received:6 hours ago

- They/He/She -Non-binary 🖤💜🤍💛 Ace♠️ + Autistic ♾️ + Vegan 🌱 🍉 🇵🇸 Pintamonas destroyer intentándolo una vez mas ✏️🙄

Jessica Len

@jessicalen.bsky.social

220 followers, 320 follows, 873 posts

Registered:4 Sep 2023 20:21

Follow date:1 Dec 2025 15:12

Last post:20 hours ago

Last like given:4 hours ago

Last like received:5 hours ago

The Cheek, The Nerve, The Gall, The Audacity and The Gumption 🩷💜💙 She/Her Señora Bi Roja Feminista Trans-Inclusiva Esclerótica Endométrica Bucólica-Pastoril El OSO, siempre el 🐻

maitecicleta 🏳️‍⚧️

@maitecicleta.bsky.social

158 followers, 64 follows, 53 posts

Registered:19 Oct 2023 16:39

Follow date:25 Nov 2025 10:03

Last post:6 days ago

Last like given:15 hours ago

Sra. Eva

@evaanvi.bsky.social

423 followers, 1,410 follows, 25 posts

Registered:17 Dec 2023 22:00

Follow date:24 Nov 2025 17:38

Last post:15 Feb 2026

Last like given:12 hours ago

Aragón, historias y falordias

@aragonhyf.bsky.social

872 followers, 193 follows, 1,276 posts

Registered:21 Sep 2023 20:18

Follow date:22 Nov 2025 19:42

Last post:4 hours ago

Last like given:4 hours ago

Aragón como nunca te lo habían contado. 🧍🏻‍♀️ Soy María Argota Recaj 📚 Historiadora (muy friki) 🎙️ #Podcast cada primer y tercer sábado de mes 🗣️ Vengo a darte la Aragoturra

Carmen GB (0000-0002-6819-9525)

@manuscriptagraeca.eurosky.social

209 followers, 219 follows, 1,496 posts

Registered:14 Oct 2023 06:48

Follow date:19 Nov 2025 21:04

Last post:14 hours ago

Last like given:2 hours ago

Last like received:12 hours ago

📜 manuscritos griegos #paleography #PhD 🧑🏻‍🎓 · 🖥 #HumanidadesDigitales · posdoc Momentum @ ILC, CSIC ·😴 daydreamer · 🧡 PDAH 🧡 · 🌹💜🍉🧶 · Eurosky ID: #7094

zsiete.bsky.social

@zsiete.bsky.social

37 followers, 69 follows, 53 posts

Registered:26 Nov 2023 10:42

Follow date:19 Nov 2025 18:52

Last post:2 Mar 2026

Last like given:19 hours ago

Señor de las Tinieblas. No me gusta lo mismo que a vosotros y lo que me gusta no me gusta tanto. Hago Amigurumis chulos en Instagram y digo tonterías en el resto de sitios. https://www.instagram.com/thel...

Ana

@vianabanjo.bsky.social

5,254 followers, 643 follows, 7,978 posts

Registered:26 Aug 2023 07:57

Follow date:19 Nov 2025 08:26

Last post:32 minutes ago

Last like given:32 minutes ago

Last like received:7 minutes ago

The blues is in perfectly unsafe hands. Watercolor & Embroidery www.vianailustracion.com

Autonoman

@autonoman.eurosky.social

1,381 followers, 2,156 follows, 21,443 posts

Registered:20 Sep 2023 15:28

Follow date:19 Nov 2025 06:20

Last post:53 minutes ago

Last like given:7 minutes ago

Last like received:9 minutes ago

Otra vez el trimestre? Ya?

NataDPB Art

@natadpb.bsky.social

586 followers, 87 follows, 385 posts

Registered:21 Aug 2023 21:28

Follow date:17 Nov 2025 22:24

Last post:31 Dec 2025

✏️🎨 Traditional Illustrator from Spain ☕ You can support me on https://ko-fi.com/natadpb 🛒 Shop: natadpb.com 📷🐦: https://taplink.cc/natadpb #art #illustration #traditionalart

Mya ⚡️

@maryagil.bsky.social

261 followers, 429 follows, 1,403 posts

Registered:20 Oct 2024 18:27

Follow date:14 Nov 2025 19:12

Last post:13 hours ago

Last like given:45 minutes ago

Last like received:12 hours ago

#Periodista #Fotógrafa #CM ⭐ Me pierdo en los libros y me encuentro en la música. Seriéfila. Friki. Cordosiesa. Más café que persona ☕️ (-o-) |-o-| 📍Cordobesa en Linares

Noëlle S. 🌷

@noleesheep.bsky.social

2,002 followers, 234 follows, 2,596 posts

Registered:2 Aug 2023 15:13

Follow date:8 Nov 2025 19:19

Last post:22 hours ago

Last like given:21 hours ago

Last like received:1 hour ago

🎀 Artista humana 🍭🐕 Pinto acuarelas, rodajas de madera y píxeles 🎨🫧 Tiendecita artesanal en el link 🛒🐑 noleesheep.carrd.co ✉️ noleethesheep@gmail.com

María 🏳️‍⚧️

@mariagarciaespino.bsky.social

833 followers, 885 follows, 3,275 posts

Registered:28 Sep 2023 20:10

Follow date:2 Nov 2025 13:30

Last post:18 hours ago

Last like given:5 hours ago

Last like received:2 hours ago

El derecho al pataleo, eso es lo que se busca. Quiero volver a casa 😭. Izquierda tricornio y brilli-brilli. Rafaella Carrà y no hay más nada.

Juan Alonso

@kokuma.bsky.social

1,448 followers, 821 follows, 1,657 posts

Registered:4 Jul 2023 16:17

Follow date:30 Oct 2025 11:21

Last post:1 day ago

Last like given:12 hours ago

Last like received:2 days ago

Sound and music computing. Programación idiota. Proyectos marcianos.

🔥 Aquelarreliquias 🔥

@aquelarreliquias.bsky.social

133 followers, 81 follows, 21 posts

Registered:16 Oct 2024 22:15

Follow date:27 Oct 2025 20:18

Tiendita de crafts, props y chismes, ahora surcando los cielos azules. Si quieres presupuesto, no dudes en escribir 🥰

Umbriel van de Lune

@umbrielvandelune.bsky.social

396 followers, 615 follows, 6,783 posts

Registered:28 Aug 2023 20:36

Follow date:26 Oct 2025 15:00

Last post:2 hours ago

Last like given:2 hours ago

Last like received:15 minutes ago

Any pronouns | Fuck fascism and fuck AI [ESP/ENG] Writer | D&D/TTRPGs | Streaming twitch.tv/uvdlune

David Skratch

@davidskratch.bsky.social

11 followers, 10 follows, 4 posts

Registered:14 Nov 2024 11:09

Follow date:26 Oct 2025 09:37

Idoia

@ptraci.bsky.social

1,509 followers, 606 follows, 7,594 posts

Registered:5 Sep 2023 20:56

Follow date:24 Oct 2025 06:09

Last post:11 hours ago

Last like given:11 hours ago

Last like received:27 minutes ago

Tengo un agujero en la cabeza por el que se me caen las cosas. Y el lapsus se hizo carne. Typos, dedazos, pipas, altramuces.

car-bonara.bsky.social

@car-bonara.bsky.social

70 followers, 103 follows, 8 posts

Registered:17 Dec 2024 21:10

Follow date:23 Oct 2025 21:13

Last post:10 Feb 2026

Mosky

@cptmoska.bsky.social

666 followers, 588 follows, 3,000 posts

Registered:21 Aug 2023 21:23

Follow date:21 Oct 2025 20:47

Last post:13 hours ago

Last like given:2 minutes ago

Last like received:12 hours ago

Blah blah comics and geeky stuff, blah blah comedy and absurdities, blah blah evolution and biodiversity. Every day is stone a nazi/sionist day. My bio in tweeter was better. I guess he/him is "ok". Banner from @gnarlyghost.bsky.social

Kurganson Rockatansky #7291 🏳️‍⚧️🏳️‍🌈🇵🇸

@kurganson.satan.social

1,112 followers, 779 follows, 43,402 posts

Registered:19 Sep 2023 10:24

Follow date:21 Oct 2025 06:16

Last post:54 minutes ago

Last like given:7 minutes ago

Last like received:3 minutes ago

Soy repunante. Prefiero ser un cerdo que un fascista. Estoy a mil jodidas millas de estar bien. Izena duena bada. No, pero me gustaría verlas.

Parador 08

@parador08.bsky.social

1,311 followers, 1,794 follows, 922 posts

Registered:11 Oct 2023 23:48

Follow date:19 Oct 2025 17:45

Last post:2 days ago

Last like given:21 hours ago

Last like received:1 day ago

Con los pies en la Tierra, la mirada en el cielo y el alma en el Universo 🌌 En Kerbin 2.0 llamado "La Tierra". PayPal: https://www.paypal.com/paypalm...